Which conspiracy theories do you guys think are true?

Grayson Russell
Grayson Russell

which conspiracy theories do you guys think are true?

Attached: flat,550x550,075,f.jpg (41 KB, 550x499)

Other urls found in this thread:

jowforums.com/thread/206228975/politics
archive.4plebs.org/pol/thread/194369224
archive.4plebs.org/pol/thread/196541993
archive.4plebs.org/pol/thread/199110112
archive.4plebs.org/pol/thread/204141788
archive.4plebs.org/pol/thread/198882770
archive.4plebs.org/pol/thread/201997900
archive.4plebs.org/pol/thread/205682550/
archive.4plebs.org/pol/thread/175292781
archive.4plebs.org/pol/thread/185365200
archive.4plebs.org/pol/thread/180380385/
archive.4plebs.org/pol/thread/191921512
archive.4plebs.org/pol/thread/172178550/
archive.4plebs.org/pol/thread/199453819
archive.4plebs.org/pol/thread/179314945
archive.4plebs.org/pol/thread/185261304
archive.4plebs.org/pol/thread/196342755
archive.4plebs.org/pol/thread/200779006
jowforums.com/thread/205468251/politics
archive.4plebs.org/pol/thread/200093468
archive.4plebs.org/pol/thread/202816632
archive.4plebs.org/pol/thread/203943955/
youtube.com/watch?v=sLCHg9mUBag
youtube.com/watch?v=uGYZ6J5F7Ng
nypost.com/2016/12/09/hillary-clintons-losing-campaign-cost-a-record-1-2b/
m.youtube.com/watch?v=JXULtYRZVPw
lmgtfy.com/?iie=1&q=gematric
reddit.com/r/conspiracy/comments/4g7jay/updated_compilation_of_confirmed_conspiracy/
en.wikipedia.org/wiki/Ophiuchus
archives.gov/files/research/jfk/releases/2018/157-10014-10136.pdf
archives.gov/files/research/jfk/releases/docid-32204484.pdf
archives.gov/files/research/jfk/releases/docid-32281870.pdf
archives.gov/files/research/jfk/releases/docid-32206626.pdf
archives.gov/files/research/jfk/releases/docid-32312562.pdf
archives.gov/files/research/jfk/releases/docid-32144493.pdf
archives.gov/files/research/jfk/releases/DOCID-32373749.PDF
archives.gov/files/research/jfk/releases/docid-32293717.pdf
archives.gov/files/research/jfk/releases/2018/docid-32989560.pdf
archives.gov/files/research/jfk/releases/2018/104-10336-10008.pdf
archives.gov/files/research/jfk/releases/2018/104-10331-10361.pdf
archives.gov/files/research/jfk/releases/2018/docid-32246622.pdf
en.wikipedia.org/wiki/Nelson_Bunker_Hunt
isgp-studies.com/belgian-x-dossiers-of-the-marc-dutroux-affair-the-accused
youtube.com/watch?v=1gHbwT_R9t0
youtube.com/watch?v=cnc_X-oDWsE
lawofone.info

Thomas Price
Thomas Price

That OP is a faggot.

Isaiah Stewart
Isaiah Stewart

All of them, obviously

Isaac Flores
Isaac Flores

that is not true

Robert Rogers
Robert Rogers

Fpbp

Wyatt Thomas
Wyatt Thomas

Not a much conspiracy. I can mathematically prove op is a fag, and a faggoty faggot at that.

Attached: 1551701524603m.jpg (67 KB, 1024x383)

Julian Brown
Julian Brown

I'm not a guy

also, this

Caleb Lewis
Caleb Lewis

sees flag
theory checks out

Oliver Wilson
Oliver Wilson

All of them, except flat earth and reptilians

Aaron Peterson
Aaron Peterson

More people have niggers in the basement than you think

Gabriel Myers
Gabriel Myers

came for this.
bless you based OP is gey poster

Luis Jackson
Luis Jackson

All burger posters are niggers or mutts

Jace Wright
Jace Wright

White genocide and Western cultural genocide (Kalergi plan); depopulation in general is real and pushed by the elites

Politics is theatre controlled by TPTB and the CIA

The CIA works on behalf of the British Royal Family who works on behalf of the Rothschilds

The illuminati is real regardless of what name you want to call it

The financial world is controlled by ~8,500 Luciferians and they work with Zionists, as said by Ronald Bernard

Everything Phil Schneider said about aliens and the government is true

Everything Bill Cooper said is true

TPTB is trying to control the world's fresh water supply

Mind control was perfected last century or even earlier, and is pushed through entertainment and academia

We're lied to about the entire human history, as well as about religion

Chemtrails are smart dust

The public is kept in perpetual ignorance and distraction because literally everything leads back to THE "monolithic conspiracy" (in the words of JFK)

It gets worse and I could go on indefinitely.

Angel Wood
Angel Wood

the earth is flat
unironically

Attached: 1552580447906.jpg (34 KB, 498x389)

Eli Gomez
Eli Gomez

I believe that Mattress firm is some sort of giant money laundering scheme. They are fucking everywhere and always empty. I remember seeing 4 mattress firms all on each corner of an intersection once, there is no way there is such a demand for mattresses

edit: a few people seem confused, I'm talking about multiple of the SAME mattress store all in close proximity to each other, not different mattress companies. Like if there were 4 different companies all next to each other I get that but these are the same company.
I believe that its a huge money laundering sheme or something far more siniter.

Attached: 5ba2a2c089c8a12f008b633a-750-562.jpg (102 KB, 750x562)

James Johnson
James Johnson

Jews

There are no others

Brayden Cox
Brayden Cox

Ocean is full of bountiful resources, but the governments stop us from getting to them.

-coast guard 'rescuing' people who try to investigate this (i have first hand experience)
-lots of negative ocean propaganda (jaws, cthulhu, water pressure, fish that swim up your penis etc, sea monsters)
-only super rich and military have submarines
-nasa did go to the moon but it was mainly a cover so they could go in deep, (all their training was water based and space people always get 'rescued' in the water)
-powerful shipping magnates
-we never really get taught to swim downwards, always across water, and when it is downwards they make it unpleasant (make us wear pajamas)

there is loads of evidence, but no-one ever talks about it

Josiah Fisher
Josiah Fisher

No but it is most likely cavernous with holes at the poles, with many untold underground civilizations human and non-human alike.

Carter Cruz
Carter Cruz

ok, I will show my home country's flag.geez

Attached: polandball---simple-kingdom-of-portugal-by-kaliningradgeneral-dah6e42[1].png (19 KB, 586x475)

Anthony White
Anthony White

Trump is a Zionist working for a doomsday cult that is attempting to start a one world government

Matthew Allen
Matthew Allen

earth doesn't exist

Daniel Reed
Daniel Reed

go on, share your knowleage

Levi Davis
Levi Davis

The UK and EU are working together to have the UK implode after they leave, so the appeal of Federal EU States look good once UK rejoins in 3 years.

Leo Taylor
Leo Taylor

Or maybe were just not very good at swimming, die easily and there's fuckall out there except fish and deepsea oil.

What are the other resources?

Luke Hall
Luke Hall

I believe they put all their secrets into fictional works, for occult magic reasons. Pic is from Return of the Living Dead. The guy can't work out where the medical skeletons with perfect teeth come from.

Attached: vlcsnap-2019-03-12-16h59m57s930.png (945 KB, 1280x696)

Jaxson Lopez
Jaxson Lopez

There's some giant criminal organization involving jews, all communist countries, and lobbyists pushing their agenda

Jackson Rivera
Jackson Rivera

I believe that Mattress firm is some sort of giant money laundering scheme

Go back to re.ddit with your normie tier bullshit.

Attached: 4744.jpg (87 KB, 768x1024)

Thomas Powell
Thomas Powell

Q.

Attached: 1551541171435.gif (350 KB, 550x510)

Easton Bennett
Easton Bennett

Attached: 1533951451146.png (193 KB, 500x452)

Aaron Gutierrez
Aaron Gutierrez

This sort of knowledge seems to be forbidden on Jow Forums.

Logan Martin
Logan Martin

It's not a conspiracy if the only person denying it is OP but still
FPBP

Ayden Wilson
Ayden Wilson

Everybody GO to the THREAD
jowforums.com/thread/206228975/politics

Attached: miss-california-nude.jpg (200 KB, 768x1024)

Jordan Butler
Jordan Butler

all of them, just to make snopes cry

Christian Davis
Christian Davis

rolf harris is innocent

Nathaniel Phillips
Nathaniel Phillips

The biggest conspiracy theory is that THEY made us think it's all hopeless, while in fact it's the complete opposite.
THEY are worried, fear instills their hearts.

Jack Rodriguez
Jack Rodriguez

it's spammed every hour though

Oliver Martinez
Oliver Martinez

not for his crimes against music

Hudson Bennett
Hudson Bennett

Sure thing

Attached: 756546B0-AA4E-4A3B-8E60-992E6E89E9B0.jpg (33 KB, 720x568)

Colton Walker
Colton Walker

Have you considered trying an anti-pyschotic

Anthony Bell
Anthony Bell

we evolved from water so shut up.

incredible resources like gold, giant pearls, sea fruits are all in the ocean. but governments don't want us to get to them 'a happy dog is a lazy dog'

Jackson Morgan
Jackson Morgan

MK ultra never ended

Jace Bell
Jace Bell

aliens
ghosts
spirits
interdimensional creatures
black budget technology DECADES ahead of what we're aware of
cults of rich bastards using countries to gain power via subjugation
dragons

Nicholas Cook
Nicholas Cook

I like this guy

Levi Rodriguez
Levi Rodriguez

Nazi UFOs
archive.4plebs.org/pol/thread/194369224
archive.4plebs.org/pol/thread/196541993
archive.4plebs.org/pol/thread/199110112
archive.4plebs.org/pol/thread/204141788

Ancient History
archive.4plebs.org/pol/thread/198882770
archive.4plebs.org/pol/thread/201997900
archive.4plebs.org/pol/thread/205682550/

the occult principles behind 9/11
archive.4plebs.org/pol/thread/175292781
archive.4plebs.org/pol/thread/185365200

False Flags (9/11 included but not as detailed)
archive.4plebs.org/pol/thread/180380385/
archive.4plebs.org/pol/thread/191921512

Pizzagate (ctrl + f "hogg" or "paddock" dor the parkland shooting or vegas shooting)
archive.4plebs.org/pol/thread/172178550/
archive.4plebs.org/pol/thread/199453819

NASA being lying pieces of shit
archive.4plebs.org/pol/thread/179314945

MKUltra and other mindcontroll
archive.4plebs.org/pol/thread/185261304
archive.4plebs.org/pol/thread/196342755
archive.4plebs.org/pol/thread/200779006
jowforums.com/thread/205468251/politics

Satanic and Occult Elite
archive.4plebs.org/pol/thread/200093468
archive.4plebs.org/pol/thread/202816632
archive.4plebs.org/pol/thread/203943955/ (focuses on freemasonry but otherwise essentially the same)

Attached: Insane.png (814 KB, 959x538)

Daniel Sanchez
Daniel Sanchez

CATATTCCATTGCAACGACTCTTGCCACAGCCAATGATC

Connor Sanders
Connor Sanders

Mainly the ones they lie about.

Camden Cook
Camden Cook

It gets worse and I could go on indefinitely.
Please go on

Jacob Reyes
Jacob Reyes

Attached: conspiracy-b.png (52 KB, 994x501)

Brody Hill
Brody Hill

water pressure is negative propaganda
I can swim just ten feet down and feel the pressure difference. You're a moron

Robert Barnes
Robert Barnes

nice pic op
look at mine
is that you IRL?

Attached: israeli-supreme-court---novus-ordo-seclorum.jpg (204 KB, 859x790)

Jose Sanchez
Jose Sanchez

jews are not that influential.

Alexander Murphy
Alexander Murphy

They groom you to join one of the government's mystery schools.

Attached: The-Last-Boy-Scout-Freemason-Shriner-Symbolism-3MB.jpg (3.09 MB, 10000x4768)

Sebastian Rogers
Sebastian Rogers


The us gov't will MKUltra you to switch genders if you cross them.

E.g. Wykowski sisters, Chlesea Manning

Bentley White
Bentley White

JFK theory of more than one shooter, killed for the government trying to shut him down
pearl harbor being staged and allowed to happen
holocaust fake or blown out of proportion.
ayy lmaos
bush did 9/11

Attached: 2DC1681A-15B9-489C-A91C-6C6BB7656A3F.png (595 KB, 1160x1079)

Lincoln Roberts
Lincoln Roberts

Everything Phil Schneider said about aliens and the government is true
not too familliar with his stuff aside that he supposedly got attacked by underground reptillians, but what we call aliens are demons and fallen angels, and yes the government is in bound with them, hence the rampant satanism

Mind control was perfected last century or even earlier, and is pushed through entertainment and academia
We're lied to about the entire human history, as well as about religion
you will probably like archive.4plebs.org/pol/thread/205682550/
jowforums.com/thread/205468251/politics

Sebastian Smith
Sebastian Smith

youtube.com/watch?v=sLCHg9mUBag

David Torres
David Torres

Google, Facebook, Twitter, all of those big tech corporations are heavily involved with various alphabet agencies and spy on users nonstop

Dylan Wilson
Dylan Wilson

if water pressure is as strong as they say it is, how are there bubbles at the bottom of the sea? bubbles! they are very delicate and don't get squashed by pressure. also lots of fish of different sizes.

if water pressure is as they say it is - how do they keep finding old wooden boats from the bottom of the sea, hundreds, if not thousands of years old?

if water pressure is as they say it is, how does that explain the fact that water takes the path of least resistance?

i'm getting attacked from all sides. big ocean has big pockets.

Juan Cooper
Juan Cooper

We never went

Attached: 7FCA7584-EA6F-431D-9A1F-B6B50F7322B1.jpg (799 KB, 940x929)

Eli Perry
Eli Perry

Subterranean alien race was here before we were, Egyptians almost drove them to extinction but now they are prevalent in our society controlling our media and politics aka Vril (Type 1, 2 & 3) + VIP could easily stand for Vril infected person/s. The lizards quill enters the left eye in said ritual excretes it's biological fluid containing it's conciousness and takes over the mind after about a month the Vril can replicate everything you can do now, it still has your memories so playing pretend is easy. Tons of proof for this.

Cloning centres in deep underground military bases (R.E.M Conciousness Transfer Machinery)

Unsure on flat Earth

Ryan Jones
Ryan Jones

If the MSM devotes some amount of time to "debunking" a conspiracy theory, while that doesn't necessarily make it true, it makes me more likely to seriously consider it. They only fire up the propaganda apparatus when they're afraid of the truth leaking out.

Jason Butler
Jason Butler

I believe the aliens are keeping us in some sort of space blockade
The few that manage to come here are the UFO sightings we had + some are fake (military stuff)

Connor Phillips
Connor Phillips

This is bait. No one is this dumb

Attached: bait-15.jpg (76 KB, 625x626)

Sebastian Sullivan
Sebastian Sullivan

Atomic/sub scale wormholes are real. There exists an extremely ancient (before humans) (before big bang) post physical technological singularity entity that most people confuse for heaven

Charles Hall
Charles Hall

donald marshall seems like a shill, i have him added on facebook.

Anthony Bennett
Anthony Bennett

Pizzagate unironically. I thought it was bullshit until I actually started looking into it, and at the absolute least, John Podesta and James Alefantis are involved in some fucked up shit, probably others as well, but those two for sure

Kevin Ward
Kevin Ward

this, and jews did 9/11

Attached: 1462387951838.webm (1.58 MB, 1280x720)

Adam Taylor
Adam Taylor

All the stuff that connects to Crowley is pretty neat
youtube.com/watch?v=uGYZ6J5F7Ng
Then you realize they're all connected to Crowley :')

Attached: nude-and-cross-eyed.jpg (116 KB, 858x606)

Isaiah Moore
Isaiah Moore

illuminati confirmed

Attached: 1550700417940.jpg (42 KB, 334x506)

Joshua Collins
Joshua Collins

I believe the 60's hippie wave was pushed by CIA to hide MKultra and other mind control experiments from being exposed. Farmers being abducted by "aliens" were ther previous experimentation subjects.
I want to believe in the pedo cult of satan but as an atheist it doesn't make sense to me. Then again boomers being religious dumbfucks is a fact, the "evidence" is there too so it can be real. The idea of TPTB larping as satanists beheading children like chickens is funny too so I want to believe.

Ayden Campbell
Ayden Campbell

the libs collectively believe that russians spent $5000 and outperformed and outmaneuvered their $100,000,000 team of top liberal minds in 2016 so that's probably the most pathetic and embarrassing conspiracy anybody believes

Hunter Perry
Hunter Perry

$100,000,000
add a zero
nypost.com/2016/12/09/hillary-clintons-losing-campaign-cost-a-record-1-2b/

Josiah Howard
Josiah Howard

Jews control the world & holocaust never happened

Nathaniel Price
Nathaniel Price

the holocaust did happen but the war didn't last long enough for complete extermination
the holocaust didn't happen and Hitler was controlled opposition
Pick one.

Jaxon Kelly
Jaxon Kelly

which conspiracy theories do you guys think are true?

none

Jeremiah Smith
Jeremiah Smith

masons shoot up bars and schools in ca

Samuel Hall
Samuel Hall

The government is gonna stage an alien attack.

Sebastian Edwards
Sebastian Edwards

Is this the power of autism?

Jason Murphy
Jason Murphy

Isn't that the picture they took right after lowering it down lol.

Angel Turner
Angel Turner

Farmers being abducted by "aliens" were ther previous experimentation subjects.

Many of the land owners in my area have stories of ufos landing on their property. The boomers have told me ufo, alien, and ghost stories that sound like the CIA mind control stuff talked about on here.

yes

Attached: Sonic-Masonic-Freemason-propaganda,-Robotnicks-Pyramid-Scheme-3mb.jpg (3.36 MB, 9063x8626)

Connor Gomez
Connor Gomez

This is fact not theory

Dylan Thomas
Dylan Thomas

ancient civilizations existed on Mars and NASA is covering it up
moonbases have existed since the late 70s at least (Wikileaks mentions this)

Samuel Sanders
Samuel Sanders

But most of us know ita true. He works for Kushner/Israel

William Gutierrez
William Gutierrez

does anybody remember that one youtuber who had a whole seriese on pizza gate? He also had a few videos on the podesta brothers, the mccane girl, and that nxxmn sex cult. I can't find him on youtube anymore... He also had a video where he explains how he had a friend when he was young who had a "hollywood" farther and had seen things that made him believe in these pedo cult conspiracys. Anyone know who im thinking of?

Daniel Nguyen
Daniel Nguyen

Femin virus is real.

Benjamin Fisher
Benjamin Fisher

This desu

Attached: IMG-5095.jpg (462 KB, 500x756)

Levi Nelson
Levi Nelson

If i remember he also had a few videos on some random girl who would livestream her horribly poor conditions and got bullied online and an hero. I'm googling furiously and can't find her name

Hunter James
Hunter James

Reptilians, but without the sci-fi bullcrap. Come at me

Colton Powell
Colton Powell

Who needs conspiracy, when history tells you clearly, the truth is much stranger than fiction.

Attached: 1551808146659.jpg (156 KB, 700x472)

Andrew Long
Andrew Long

Space is fake

Nathaniel Morgan
Nathaniel Morgan

bump

Kayden White
Kayden White

guys my mattress conspiracy theory makes a lot of sence.

Attached: ir163-briefs-kek.1.jpg (67 KB, 800x800)

Henry Kelly
Henry Kelly

do govts go out of the way to make their buildings look weird?

like seriously? Why do they have to have some egyptian symbolism?

Attached: 1543201034864.gif (767 KB, 500x530)

Anthony Butler
Anthony Butler

That's just the plot to battlestar galactica

Ryan Thompson
Ryan Thompson

stop watching so much infowars

Benjamin Ward
Benjamin Ward

The only one that has been 100% verified (besides flat earth) is that Hillary eats babies.

John Clark
John Clark

m.youtube.com/watch?v=JXULtYRZVPw

Attached: thumbshowmecurve.png (960 KB, 1600x929)

Camden Ward
Camden Ward

Pic related is Lake Pontchartrain in Louisiana. Google something like "Lake Pontchartrain electrical wires"

Matthew Brooks
Matthew Brooks

Mattress Firm
Mattress
Firm

Tyler Evans
Tyler Evans

I like this theory, because it means that I can breed with a qt3.14 halfsnake girl gf. I unironically believe this though, because you have things like operation paperclip and the german reich expedition to Antarctica, and that one dude's precise notes on the place with things like giant bioluminescent fungi eating the massive heat, causing the light in the underground and opening massive amounts of possibilities for the creatures there.

Attached: 6a45cd314cc2fdda2a7b7e41149713da.png (843 KB, 867x1200)

Zachary Foster
Zachary Foster

Tons of proof for this
sauce pls

Joshua Thomas
Joshua Thomas

Muslim terrorists committed 9/11 but Osama bin Laden did not orchestrate it.

The IMF destroyed developing economies and engineered the migrant crisis by financing corruption, civil wars, and resource exploitation with loans that would be impossible to repay under the circumstances, forcing countries to devalue their currencies and become hopelessly dependent on foreign investment. Their agenda is global financial recolonization and distraction through simultaneous SJW and neo-nazi propaganda, dividing the global counterculture and focusing them on useless, made up race issues.

Attached: 50954288-147769999550409-3987112789071101952-n.jpg (60 KB, 634x960)

Nathaniel Edwards
Nathaniel Edwards

pee is stored in the balls

William Ortiz
William Ortiz

well you said some interesting things, i believe the Kalergi plan is real aswell whatever name you wanna call it, we are being replaced to one single brown race without an identity that the elites will rule, as i look as it USA is isreals golem, the one to break crush and take the heat in disguice for isreal to prosper.

the way i look at it, humans has been roaming for 100000s of years, some group must have thought at some point, how do we subverb the others into submission, that tribe is the jews. Everyday i see unhonest people who has only their own desires in their thought, the chance of there not being a group who has the goal of submission of the whole world in their agenda is small

my 2 cents

Dominic Richardson
Dominic Richardson

Desu I'm so deep in the rabbit hole I know the background stories of 90% of the stuff Alex Jones has ranted about on Joe Rogan's podcasts. What I think and know is so far out there that I look at Jow Forums like you look at Nosebook.

Attached: its-way-worse-than-you-think-it-is.png (107 KB, 500x397)

Ethan Richardson
Ethan Richardson

That’s why the technical term for scrotum is “pee bag”

James Cruz
James Cruz

please, user, share with me some of your trivia or/and thoughts

Jose Turner
Jose Turner

For an example.

The numerological and gematric (((coincidences))) in horrific mass deaths, (((terrorist attacks))), celebrity/political leader deaths and assassinations are not predictive programming or the perpetrators "telling us what they're doing", but they're crucially important, as those are ritual sacrifices for what Alex described multidimensional aliens. Said beings are giving the beings in charge behind the scenes tech in exchange, and they've been doing it since 1600s. These beings in charge have their lineage date back to Atlantis, they're not of human origin. All the Abrahamic religions' texts are filled with encoded shit that refers to things that precede our current written history by tens of thousands of years. Again, this was done by the same beings of that lineage.

Oliver Campbell
Oliver Campbell

Will post more on request.

Lincoln Johnson
Lincoln Johnson

Do you believe you're able to communicate with them on DMT?

Angel Long
Angel Long

No, I don't. I KNOW I'm able to communicate with interdimensional entities without any drugs, and I know people who can see them.

Camden Myers
Camden Myers

Requesting more.. pretty pls

Brody Bailey
Brody Bailey

yah ive done a lot of shrooms also, bro

Nathaniel White
Nathaniel White

It would be faster to tell you which conspiracies I DON'T think are true, namely:
-Flat Earth
-Russiagate
-Chemtrails
-Aliens
-Cryptids
-Mandela Effect
-Jesuits are the real elites, and use Jews as scapegoats
-Transvestigation nonsense
-Alex Jones is Bill Hicks, or: ____ is ____ (insert celebrity A and B here)

Hudson Morgan
Hudson Morgan

it's not fair to put chemtrails in there. why would it be silly to to think weather modification is real when billions or trillions of infrastructure is at risk?

Charles Brooks
Charles Brooks

Angels, demons, Gods and extraterrestial lifeforms. They're all real and many of them are present in every person's daily life. Our consciousness is a transreceiver, and it's not inside our heads, it's in and outside our bodies, and when we look at things, or think about things (regardless of distance or presence of line of sight), the presence of our consciousness has an effect on the target of our thoughts. You know the thing you think is YOU having an inspiration or a new idea? Odds are that's not you, that's angelic or demonic entities communicating to you the only way they can to a person who's not 'unstable'. You read other people's thoughts, intentions, past deeds and beliefs as you see them. Unless you're properly initiated, you'll just get a feeling about a person, maybe you like them or not, trust them or not, and so on. Properly initiated individuals can tell their own thoughts and attempted communications apart, and they can articulate what they see in people and why. You know how all the Rockefellers and Rothschilds start to look like real-life zombies and abhorrently disgusting? Because as people get older, their bodies start to acclimate to the energy they're exposed to, and thus the darkness starts to "shine through".

I've never taken any psychotropic drugs in my life, I never had to.

Charles Moore
Charles Moore

aliens
conspiracy
not real
Go back to /r/atheism

Brody Lee
Brody Lee

what does "gematric" mean and why is information about all-power atlantis bloodlines matters to me

Ian Hall
Ian Hall

The world is literary fallen

Attached: Screenshot-2019-03-15-02-15-06-551-com.android.chrome.png (519 KB, 1080x1920)

Ethan Clark
Ethan Clark

Obscenely good tastes, bro

Attached: 1438541804003.jpg (653 KB, 1200x1688)

Levi Hernandez
Levi Hernandez

Any that can be connected to (((them))) profiting in a way

Matthew Reed
Matthew Reed

extraterrestial lifeforms
demons

Leo Nguyen
Leo Nguyen

DMT "entities" also demons

Luis Reyes
Luis Reyes

Wholesome

Adrian Davis
Adrian Davis

So what's the deal with textbook cases of schizophrenia on this board?

Attached: whatsthedeal.jpg (64 KB, 1536x960)

Kevin Carter
Kevin Carter

Weather modification (cloud seeding, HAARP, etc) is real. But that doesn't mean that large-scale "chemtrail" spraying using aluminum nanoparticles is real. The grid pattern is formed by wind blowing contrails away from flight paths. The persistent contrails are the result of certain atmospheric conditions, which is why you only see them during certain times of year.

Blake Hughes
Blake Hughes

what does gematric mean
What the fuck did I say in my OP?
lmgtfy.com/?iie=1&q=gematric

why is information about all-power atlantis bloodlines matters to me
If you don't know your history you're doomed to repeat it. Moreover, if you don't know why and how you're being controlled, how are you supposed to set yourself free? How are you going to fix anything if you don't know you're damaged/crippled?

Brody Ross
Brody Ross

The serpent whispers in the ears of knowledge seekers. Knowledge is bait. All you need to know is to seek Jesus. He only can save humanity from this dark pit of sin.

Jace Howard
Jace Howard

Psychiatry
Doctors for the soul
Creepy, isnt it?

John Wood
John Wood

Fluoride in water. It provably lowers IQ.
Yeah it's good for teeth but it's supposed to be a fucking topical treatment. Like those styrofoam fluoride trays dentists insert in your mouth for a few minutes and tell you not to fucking swallow. Even the back of your toothpaste tube says not to swallow that shit.

Attached: 1498787802729.jpg (98 KB, 650x650)

Ryan Reyes
Ryan Reyes

Beware the noetic dragon

Attached: 1552585888642.jpg (111 KB, 339x581)

Nathan Davis
Nathan Davis

You're swimming way out of your debt... *cough* I meant depth, half-T*rk.

Levi Morales
Levi Morales

There's a conspiracy on this meme image called "ocean at night." The idea is basically that there are creatures that live at the bottom of the ocean and never venture anywhere near the top, so they are completely unaware that a surface world exists. However, by blasting industrial lights into the ocean and other human activity, we are making them aware and will end up waking some Cthulhu monster.

Attached: 1550887993908.jpg (2.22 MB, 1200x7000)

Elijah Russell
Elijah Russell

Fucking all of them

Xavier King
Xavier King

what do they say they look like?

Nicholas Flores
Nicholas Flores

this

they exist for a reason

William Hill
William Hill

CIA killed JFK

Cameron Brown
Cameron Brown

Attached: tol4a0e952m21.jpg (27 KB, 800x450)

Leo Bailey
Leo Bailey

I would argue the Rothchilds are below the Queen in the rankings of Oligarchy.

Angel Wilson
Angel Wilson

That the globalists are mostly Jewish
That Jews control all the propaganda, "news" networks and mainstream media in the US
That Jews are actively pushing propaganda to degenerate all other races
That DC and Hollywood are tied to a huge pedophile network
That the Clintons have used their money to "get rid" of close to 100 people. ("Can't we just "drone" him?" Talking about Julian Assange.
That Israel false flags itself every year about this time, I have been asking the past few weeks what the false flag was going to be this time, since they tried the "Syria gasses itself" two or 3 times in the past couple of years. Every year around April they false flag themselves trying to keep US military forces in the middle east to protect them.

Xavier Young
Xavier Young

This one

Attached: 681181F7-8F65-4C00-BF99-8BE0922E32F3.png (969 KB, 750x1334)

John Stewart
John Stewart

Attached: image.gif (2.05 MB, 480x271)

Jaxson Gonzalez
Jaxson Gonzalez

... go on....

Juan Reed
Juan Reed

Pirates never existed.
They were a meme the British created and perpetuated with other countries so they'd have control of markets.

Justin Murphy
Justin Murphy

Reptilians are descendants of the Angevin/Plantagenet dynasty and carry a 'psychic gene'

The 'Illuminati' is access to their blood, blood orgies and unlimited money.

The Order of St.John and British Freemasons recruit celebrities and work together with Tavistock psychiatrists to control the world.

Tavistock's medical wing created amylnitrate and AZT and used the latter to kill users of the former and called it 'AIDS'.

Jimmy Savile was head court jester of the British Royal Family and his "scandal" covered up modern 'reptilian' practices.

Auschwitz was a human experimentation project from the start and was supported by all sides.

Pizzagate is real and there's evidence of several of them visiting Tavistock and it's American affiliates.

Eli Rogers
Eli Rogers

What is the monolithic conspiracy?

Easton Jones
Easton Jones

“DB Cooper” was probably some kind of secret squirrel, to know the 727 could open rear ramp in flight and the rest of the little details he knew/took care of before jumping.
I also believe he died that night, for what it’s worth
Also have my doubts about the holocaust, and definitely buy into the jooz shit 85% of the time.
Don’t think 9/11 was an inside job or faked, but am suspicious about Silverstein and others who have benefited greatly from it.

Jose Scott
Jose Scott

Rothcild 1988 magazine announced a one world currency and the crypto Currency XLM or Stellar Lumens just changed their logo to the circle in the center of the 1988 cover on the Phoenix. I got no sleep sonic cant get the side by side...so have a Moloch owl on the dollar as a pic.

Attached: owl-dollar-bill.jpg (62 KB, 416x560)

Adrian Jackson
Adrian Jackson

Even the chinese pirates that fucked up their dynasties?

Attached: 1544159847282.jpg (43 KB, 828x720)

Oliver King
Oliver King

95% of people are trash
even David Ike.

Attached: 1547857899961.jpg (41 KB, 249x249)

Samuel Barnes
Samuel Barnes

That obama was a gay prostitute

James Jones
James Jones

We're both Right-Hand Path oriented so we only choose communicate with Light entities. They're generally shapeless forms of light of different colors and textures. They have distinct voices and presence. I'm not sufficiently adept so to see them, and only tell them apart from my own thoughts.

They remind you of the wisdom of the Light around you through whatever your medium is. For people who read books they remind you to read page A from book X, for people who listen to podcasts and watch lectures they tell you to look up clip B from Y. Sometimes they just straight up remind you of a quote you read or something someone said. Other times they provide you with solutions to problems.

For reasons I'm not going to go here, we're not generally approached by beings of the Left-Hand Path. I've met them too though.

Luke Perry
Luke Perry

Even them.
One.
Big.
Meme.

Gavin Lewis
Gavin Lewis

Chemtrails are real. Many days you can see a contrail and chemtrail side by side. 2 totally different phenomenons you can even see it feather and and blot the sky. Aliens also fucking exist

Lincoln Russell
Lincoln Russell

Black people do not exist

Jose Miller
Jose Miller

Damn,....now that you mention it, the logistics of pirating back then don't make any sense

Nolan Russell
Nolan Russell

Alphabet Boys + The Mafia killed JFK. Kennedy was trying to crack down on both groups, so they teamed up to kill him

Josiah Gonzalez
Josiah Gonzalez

What logistics? Just get a crew of dudes with an old junker that you got from being a sailor/merchant or stole and hijack regular merchant ships and their cargo.

John Howard
John Howard

If you wanted money, you'd pocket the cargo yourself, sell it on the black market and "Oh gosh darn, those pirates got me on the seven seas! Blackbeard himself was there".

Nathaniel Cook
Nathaniel Cook

there's the eating and drinking and scurvy logistics shit, you know. no big deal.

Levi Miller
Levi Miller

The West wants to weaken and further partition Russia, it already achieved a part of that goal by creating separatist countries such as Belarus and Ukraine, and now it wants to alienate them, make them as distant from Russia as possible, for them to turn on us. The West wants Russian statehood to disappear/for it to be contained within Moscow and a small chunk of land north-east to it.

Attached: russia.jpg (53 KB, 604x358)

David Jones
David Jones

there's a list on a site we all dislike:
reddit.com/r/conspiracy/comments/4g7jay/updated_compilation_of_confirmed_conspiracy/
Also pizzagate is definitely true, yet it's probably a tip of the iceberg of blood "sacrifices" (medicinal manipulations) with rejuvenating effects (and thus myth of vampires is based upon some truth)

Attached: c3wNLAA3BiQ.jpg (51 KB, 300x450)

Oliver Kelly
Oliver Kelly

(The West) wants to weaken

Camden Powell
Camden Powell

The Holocaust was not an intentional extermination. It was imprisonment with the intent to force relocate.

It should have been an extermination.

Joseph Baker
Joseph Baker

more ? how are you initiated?

Jackson Collins
Jackson Collins

More power to them and godspeed!

Xavier Thompson
Xavier Thompson

Who else here giantpilled?

Attached: maxresdefault[1].jpg (133 KB, 1165x718)

Matthew Evans
Matthew Evans

bradley manning was programmed to become a woman as a deterrent to other whistle-blowers
you give our secrets
we take your balls

Attached: memeops.png (736 KB, 774x809)

Jace Flores
Jace Flores

The cold war ended

Logan Scott
Logan Scott

because they are all judeo masonic niggers. in example pic related.

This is in front of the IRS building 5000 Ellin Road. you see for once he 2 pillars boaz and jachin, symbolizing the sun and the moon, famous freemason imagery. also probably representing the 2 temples (like the twintowers were too)that got destroyed on tisha bav, a jewish holiday associated with destruction of their 2 temples and other misfortunes. the 2 pillars are seperated in 13 parts. In Base 12 mathematics ancients used across the world and is still used today (12 inches in a foot, 12 months in year, 2 times 12 hours a day, 12 Zodiacs, etc.) 13 is the end of the old and a beginning of the new (world order?)
Also there is also the 13th zodiac being the serpent bearer
en.wikipedia.org/wiki/Ophiuchus
like the serpent in garden eden.

The pillars are black and white, symbolizing the duality of good and evil, as above so below etc. with the hands doing the as above so below gesture even.

The pyramid is a symbol of hierachy. Also in old times they thought the gods live on the mountains, so people build their own mountains (zygguraths/pyramids) to reside upon them with themselves being the capstone, the all seeing eye overlooking their realm
In this case on the pyramid is written „we the people“ together with the constitution on the black part, the white capstone on the other hand, the top of the hierachy, the godlike elite is seperated from the constitution and its rules, literally above it

Attached: IRS-building-front.jpg (59 KB, 434x220)

Jaxson Hall
Jaxson Hall

Pizzagate, 9/1, the fact that Kikes and certain (((politicians))) are controlled by a one world organization that wants to control us and subvert us all.

Asher Wood
Asher Wood

dude you gotta explain more this is some broad shit

Ryan White
Ryan White

Rules. Tits and timestamp or GTFO.

Grayson Russell
Grayson Russell

would like to hear more about this.

Angel Young
Angel Young

communism

Benjamin Gonzalez
Benjamin Gonzalez

I think the same about Dollar Tree/Family Dollar. They are EVERYWHERE and there are too few customers for them to be making any money.

Luke Robinson
Luke Robinson

Initiation can happen in multiple ways. Sometimes through blood (inherited), sometimes through personal interest or exceptional events, other times through drugs or tragic events. But you don't need drugs. I've met an angel of death with zero drugs in my bloodstream. I know because the sighting was independently corroborated by an unwitting family member the next day.

Astral projection? That's real. You can travel to places independent of time or space. If you're in somewhat in-tune with yourself, you'll do this in certain dreams, and after you wake up, you can feel the difference. Before coming here you signed a soul contract, and unless you're an exception, you have a guide present here, who will be do 'cameos' in your dreams. Suicide is nothing but pressing the reset button on a gaming console, you're going to have to repeat it. This can be confirmed by certified hypnotists who do regression therapy - people in deep trance can recall events prior to their birth. Telepathy's real, and the whole reductionist materialism spiel is ironic, considering that Descartes himself described he got his ideas in visions from angels of God.

Your thoughts, words and actions become reality, so be careful what you think and say on a daily basis. We are mostly water after all.

Isaac Thompson
Isaac Thompson

I am unironically starting to believe this.

Dominic Thompson
Dominic Thompson

The CIA killed RFK

Justin Garcia
Justin Garcia

Space Force already exists.

Attached: USSS-Hillenkoetter.png (1.79 MB, 2230x1463)

Logan Barnes
Logan Barnes

the whole JFK assassination was possibly just a misunderstanding because it wasnt made "sufficiently clear that assassination should be excluded from consideration". Page 18
archives.gov/files/research/jfk/releases/2018/157-10014-10136.pdf

Russia says Johnson killed Kennedy, Page 5
archives.gov/files/research/jfk/releases/docid-32204484.pdf

30 pages missing
archives.gov/files/research/jfk/releases/docid-32281870.pdf

Tippett meant to kill Kennedy and be killed afterwards, Page 3
archives.gov/files/research/jfk/releases/docid-32206626.pdf

Tippett together with Rubenstein and possibly Oswald, Page 2
archives.gov/files/research/jfk/releases/docid-32312562.pdf

Multiple shooters and bullets
archives.gov/files/research/jfk/releases/docid-32144493.pdf

(((Assassination)))
archives.gov/files/research/jfk/releases/DOCID-32373749.PDF

Cuban exiles apparently planned on killing cuban government officials
archives.gov/files/research/jfk/releases/docid-32293717.pdf

Talks about "black bag jobs" against domestic targets and "do not file" procedure. Page 6
archives.gov/files/research/jfk/releases/2018/docid-32989560.pdf

appearently some George Bush that wasnt at the CIA handled some of the JFK files
archives.gov/files/research/jfk/releases/2018/104-10336-10008.pdf

Bush was friends with Morenschildt, a friend of Oswald
archives.gov/files/research/jfk/releases/2018/104-10331-10361.pdf

archives.gov/files/research/jfk/releases/2018/docid-32246622.pdf
Bunker hunt, this guy
en.wikipedia.org/wiki/Nelson_Bunker_Hunt
was questioned on the day of the assassination and 15 minutes away when Robert Kennedy

Attached: Do-it-for-him.png (1.26 MB, 1023x764)

Wyatt Ross
Wyatt Ross

I don't want to sound like an arrogant asshole or a tryhard-mystic LARPer trying to win internet cool points, but I did mean what I said in my OP ITT

To explain all of this in-depth would be easily 100+ hours of lecture material, not a few Jow Forums posts.

Colton Martin
Colton Martin

I agree with everything you say. What do you think about:
John and Robert Kennedy (killed by jews? Jack Rubenstein (Ruby) killed Oswald to cover up)
9/11
Sandy Hook/Parkland
Alex Jones (Controlled Op?)

Angel Robinson
Angel Robinson

I'm not, but go on. Looks interesting

Attached: 753717344.jpg (69 KB, 502x908)

Isaiah Torres
Isaiah Torres

The Amazon rainforest is manmade.

Robert Morales
Robert Morales

You're not wrong but it's nothing personal. It's just that Russia has a lot of power potential because of what it has and where it's at. Russia can launch wars against half the globe without sailing anywhere.

Landon Lewis
Landon Lewis

my hometown's meme is literally giant lady. it's the one thing we are known for

Wyatt Adams
Wyatt Adams

I believe this one, too.

Carson Reed
Carson Reed

isgp-studies.com/belgian-x-dossiers-of-the-marc-dutroux-affair-the-accused

Ayden Wilson
Ayden Wilson

What's the difference between right and left handed paths?

Colton Turner
Colton Turner

Have you ever wondered why modern liberal laws seem so anti-family and even anti-human nowadays? Like most things, it's worse than you think it is. Here's the short version
Left-Hand Path dark occultists run shit
they decide they want employ Luciferian doctrines into the mainstream society
they start think tanks that have founders with openly Left-Hand Path occultist society members as founders
the think tank starts to repackage Luciferian ideas as liberal agendas such as human rights issues, muh post-birth pro-choice, etc
think tanks disseminate the ideas to universities
universities disseminate these ideas to the public
pleb politicians present the ideas as new laws
politicians turn proposals into real laws
None of this is coincidental, and the proof is in the pudding: the founders of and people behind the think tanks are openly from occult backgrounds.

Hudson Allen
Hudson Allen

By that logic you may as well include the founding fathers and America as a whole.

Anthony Peterson
Anthony Peterson

Without overestimating my understanding, I could write a book on this. Having said that, it reduces down to this:
taking the Left-Hand Path is to turn away from God, Light and Creation in order to make oneself the focus of existence
The Right-Hand Path is the path of giving, whereas the Left-Hand Path is that of taking. The Left-Hand Path is about being and becoming the God you turned away from, and more importantly, rejecting the beauty, innocence and Light that comes along with Creation. Luciferians are the quintessential travelers Left-Hand Path.

What we in the West consider pure evil, that's the essence of the Left-Hand Path. What we consider as benevolence, that is the Right-Hand Path. It's obviously much more complex and nuanced than this, but I hope you understand what I'm saying.

Robert Myers
Robert Myers

OP it's barely a conspiracy

Let's see the calculations, else I am thinking you are the Royal faggot around here

Attached: 1552539649027m.jpg (55 KB, 1024x682)

Aiden Mitchell
Aiden Mitchell

You might want to look at your country's history, and the architecture and the layout of your capital city, the story's seriously grim. Looking at your history, even on post-WWII level, can you really look at the systematic, non-stop bloodshed of literally millions of civilians overseas over the course of half a century, and say your country has been a force for good in the world? Nigger please.

Having said that, it's not like it's YOUR fault.

Andrew Lewis
Andrew Lewis

Why do the nations ragea and the peoples plot in vain?
2The kings of the earth take their stand and the rulers gather together, against the LORD and against His Anointed One:
3“Let us break Their chains and cast away Their cords.”
this is the liberal agenda, liberation from God, his law and morals which are the chains and cords that hold them back.
"Who is God to tell me what gender I am, I decide it myself? *cuts of dick*
"Who is God to tell me what to do with my life, I live my life myself?" *takes drugs and whores around without end* *dies from aids or OD*
"Who is God to tell me what sexuality is correct?" *indoctrinates children with gay and tranny agenda*
"Who is God to tell me what to do with my body?" *gets chain abortions* (read institutionalized childsacrifices to moloch)
Personal liberation movement is just rebellion against God pushed in an atheistic/materialistic/hedonistic (satanic) framework.
and it this lies the core of most occult schools like the Masons and Crowleyism and Satanism, except those go into the spiritual as well and either openly rebell against God or say "God created good and evil, thus evil is just another part of God to be embraced" or "There is no God, thus there is no objective right or wrong and thus everything is free game"

Owen Cooper
Owen Cooper

Can you recommend any books on Vril? I’ve read The Coming Race, which introduced me to the concept, but haven’t read anything non-fiction.

Camden Ortiz
Camden Ortiz

Crowley is on the roster with Hitler for dark characters I'm intrigued by.
He's severely terrible tho.

Dominic Hughes
Dominic Hughes

Not even conspiracy bro that is plain facts that are simply ignored by the masses

Eli Lewis
Eli Lewis

By the way, atheist?
Are you extremely or severely retarded?

I'm joking, I just feel had.

Atheism is a psyop.
The Jews screwed your head, brocious.

Bentley Thomas
Bentley Thomas

Amen to that, based Kraut. I'll say this just in case: you should never forget to describe the 'chain of command' in this, otherwise people of the liberal persuasion are likely to dismiss you as a fundamentalist wack job. Always leave a trail of bread crumbs for the lost to follow.

Kevin Stewart
Kevin Stewart

I didn't mention JFK. It was RFK who was killed by the CIA.

JFK was probably shot accidentally by his own bodyguard.

Nathan Perez
Nathan Perez

the nephilim

Matthew Diaz
Matthew Diaz

earth is flat

look at this (((fellow lady))) try and say its a sphere

youtube.com/watch?v=1gHbwT_R9t0

Adam Martin
Adam Martin

soul contract
Sauce on purpose and terms?

Anthony Garcia
Anthony Garcia

I want to believe in the pedo cult of satan but as an atheist it doesn't make sense to me.
Look up FINDERS cult. Like most things, it's worse than you think it is.

Joseph Reyes
Joseph Reyes

oops wrong link heres the correct one. The black guy completely BTFO's her out

youtube.com/watch?v=cnc_X-oDWsE

Luke Ward
Luke Ward

3/11

Attached: 1551559640852.jpg (74 KB, 1024x782)

Liam Harris
Liam Harris

pic related
Last print I read was from the late 90's. Among other sources, you can find strong parallels in channelings of Ra.
lawofone.info

Attached: 51HBp8a6yRL.-SX332-BO1,204,203,200-.jpg (55 KB, 334x499)

David Evans
David Evans

Be benevolent not selfish
Good theory. What does this mean for evolution? Benevolence apparently evolved to help kin groups kill others. If I try to be benevolent, doesn't that mean I get obliterated?

Gabriel Long
Gabriel Long

I'm reducing books into sentences to provide any form of clarity to a targeted group whom I assume to share a certain baseline of knowledge.

You're so far off we might as well be speaking different languages. It's clear you still believe certain aspects in science don't have an agenda built-in. Yeah, it's just a (((coincidence))) mainstream (((science))) doesn't think free will is real.

Read my post mention Descartes and look it up. History isn't fact, it's HIS or HER story.

Evan Moore
Evan Moore

*mentioning

James Baker
James Baker

How do I get in touch with an higher power?

John Ross
John Ross

God is omniscient and and sees all of time, would this not mean our decision are predetermined?

Angel Evans
Angel Evans

/thread

Nathaniel Powell
Nathaniel Powell

Journey of Souls
Read it, seemed unverifiable and sounded made up. It feels good to read, unlike all the real redpills.

Evolution is fake
Nigger, explain why my cat is biologically optimized for bird hunting then. (His obesity prevents him from actually catching any.)... Oh shit you're right! My life is karmic consequences for owning an obese incel cat.

Prove you're not a shill: what should be done to fix white demographic genocide in every white country?

Adrian Reed
Adrian Reed

tits or gtfo

Brody Rivera
Brody Rivera

Holy shit. He cut out the oil guys, in a way that made sense. Therefore, he must be a Nazi.

OMG. (((THEY))) have made Walt Disney a Nazi in the eyes of the people who think beyond the normies. (In a world where the worst thing you could possibly be is a Nazi.) My brain is exploding. Holy shit.

Kevin Brown
Kevin Brown

That's a highly complex question. I don't know anything about you. I can give you some basic advice but it assumes a lot of things, like that you're genuinely trying to be honest with yourself, that you haven't warped your worldview into shit with lies and self-deceit, that you weren't abused as a child to the point where you couldn't tell right from wrong even if your life depended on it, etc, etc. Having said that, here's my advice
quit alcohol and/or drugs for three weeks or more
stop speaking and do your best to stop thinking things you know to be untrue
allow yourself to be alone and silent for a while every day
ask for the light beings' guidance on things where you seek to positively improve your and other peoples' lives
You'll have glimpses of solutions, ideas, changes that need to take place. I know they'll feel like yours, and as long as they're positive in nature and in intent, make them happen. The Angels here to help us, and they're here for every single one of us. As we speak, there's at least one in the same room with you at this very moment. I talked about this before ITT, we hear their communications as our "own ideas".

Wyatt Scott
Wyatt Scott

Jesus Christ is the one true God and is not defined by the words of your meme.
The God your words describe does not exist. God is love, but all is not love, God is too pure and perfect to accept sin in His presence.
Jesus Christ died on the cross as an act of atonement.

As a living being you are offered the chance to accept the love token of the almighty.
You may choose in your free will to reject the offer.
To willingly reject the offer of salvation means eternal separation from the source of life.

Andrew Wood
Andrew Wood

Michael Jackson was innocent

Elijah Morris
Elijah Morris

Easy way: contact demons

Harder way: cry out to Jesus.
He will save you but to stay in close contact with His spirit requires a daily walk of surrendering ungodly things.
It hard but it good.
I been up down in and out. Being Christian is the best.

Colton White
Colton White

“I, Jesus, have sent my angel to give you this testimony for the churches. I am the Root and the Offspring of David, and the bright Morning Star.”

Attached: index.jpg (12 KB, 322x157)

Camden Wilson
Camden Wilson

God is omniscient and and sees all of time
Maybe, but not necessarily. Your statement implies a million underlying assumptions about things that I don't agree with.

would this not mean our decision are predetermined?
No. This statement is based on baseless axioms, such as
1) you're trying to apply linear causality to an entity that perceives no time (causality as we understand it wouldn't exist [as time doesn't exist])
2) "predetermined" implies our existence is singular and linear in nature, instead of a normal distribution -type set of input-outcome streams[, which happens to be also implied by modern physics theories]

Mason Hughes
Mason Hughes

Pizzagate has been reduced to, "You actually think Hillary Clinton was running a pedophile ring out of a D.C. pizza shop. LOL!"

These are some evil fuckers and I don't know how to fight them.

William Powell
William Powell

Music is a form of spell casting. I would like Finish occult user to expand on this because he seem to be able to put the idea in words better than I could.

Michael Fisher
Michael Fisher

Read it, seemed unverifiable and sounded made up.
Given your background ITT, I sincerely doubt that, but you're free to post a photo of the book with timestamp.

It feels good to read, unlike all the real redpills.
That's an interesting, particularly emotional argument for dismissal.

Evolution is fake
I see you jumped into the
let's just make shit up
category. What's next, you gonna call me a creationist or a christcuck?

Aiden Ramirez
Aiden Ramirez

tarrant's an mossad agent

Attached: star.jpg (23 KB, 350x338)

Cameron Kelly
Cameron Kelly

What im saying is that if theses beings can perceive time as we do space, how would a being within our dimension alter the "physical" reality of another? I can smash a rock on another rock, but could a 2d being have any importance when it came to that rock?

Dominic Allen
Dominic Allen

im kinda shit at explaining it , but i hope it makes some sense

Angel Robinson
Angel Robinson

I agree. I'll take a shot at that, sure.

Music is indeed a higher form of spellcasting than the mere utterance of words in sequence, and I don't say that to downplay the importance and the talismanic nature of certain words and symbols. I assume you understand how chords and harmonies are mathematical in nature. Like performance of music, the act of composing music is to transform intent into universal harmonics of the universe.

Most of the time the composer functions as a channel between the higher density entities and our material world. The composer effectively delivers their intent and their own spirit into their work in a way that lacks the many abstraction layers of language - that's why what we regard classical music still has a deep and lasting effect on us.

And just like everything else in this world, this talent is a force that can be used for good and evil.

Levi Taylor
Levi Taylor

Does someone know to translate wats written in pic?

Cameron Lopez
Cameron Lopez

1. I believe that reality as we know it is basically manufactured theater. Because of this I am finding it hard to communicate with the general public.

2. I believe in the concept of love is the key to the universe/higher power

3. Not abused in any way.

4. I generally dont drink, I think its poisonous to the body. No drugs what so ever. Quit porn and fapping 6 months ago

5. I try my best but everything around me seems to be untrue, so if I do that, I will have no communication with anyone.

6. I Meditate 10 minutes daily, is that enough?

7. I dont do this when I meditate. I will start.

Eli Jackson
Eli Jackson

Like I said, you seem make various assumptions based on the knowledge you already have, such as that dimensions and time behave in a linear fashion. I understand why you'd think that, it's what we're taught in school, but it's incorrect. Like I said before, time and causality is more like a large array or a set of probability streams that meet at the present, and to view it from the outside does not imply one deterministic, or a single string consisting of "past-present-future".

Do you want to reformulate your question? You're clearly not being ass about it so I'd be happy to try and answer you properly.

Kevin Harris
Kevin Harris

Idk man I guess it just come down to why or why aren't we important in the grand scheme of time and space, and how do we know our choices are ours

Wyatt Rogers
Wyatt Rogers

Attached: 2019-03-15-03h00-15.png (421 KB, 400x693)

Ethan Long
Ethan Long

muh hippy feel good woo
Doesn't fucking work. Go back to /x/.

Thread topic is REDPILLS. Probably datamining but who cares at this point.

Here's a redpill: a cabal of investors control the media, government, public education, military and religious leadership. They hate technology progress (it's risky) and love increasing their own control.

Dylan Ward
Dylan Ward

spellcasting

Please just fucking die immediately, please.

Oliver Reyes
Oliver Reyes

1) I understand, and in many ways you're exactly right. It's not just about the news, politics or public perceptions. We're being systematically lied to about the very nature of existence
2) You have seen the Light, I'm glad. You might want to refine your ideas on that. Understanding the difference between love and absence of it might be useful for you. I mentioned a site that might help you do that
www.lawofone.info
3,4) That's all good, mate
5) You may want to focus on separating yourself from the behaviors of others and perceptions being fed to you
And I mean that you shouldn't purposefully drown yourself in what you know are lies about the world, that's just demoralizing, but to be able to maintain a buffer zone between what others think and feel and what you feel in any way "vulnerable to " is a matter of great importance for your well-being in the long-term.
6) Meditation is to a certain extent overrated. Losing yourself listening to music is meditation. Taking a stroll in the forest and just focusing on breathing in and out is meditation.
7) Prayer and genuinely benevolent thought is all good. Read up on Masaru Emoto. Thoughts are reality. Music is reality. Most importantly, harmony is reality.
I honestly think you're on a good path, and you don't have to take my word for it. The most important thing is to be able to look yourself in the mirror and smile without lying to yourself about what and who you are.

Carter Thompson
Carter Thompson

Oh but we are important. We're just being told we're unimportant. That's why we don't have free will according to (((them)))!

I don't think it's important to know our choices are ours until the soul reaches a certain point of maturity.

Leo Perry
Leo Perry

explain why my cat is biologically optimized for bird hunting then
Adaptation to their environment. Evolution is only a theory, not a law. We could argue about it, but neither could be proven right or wrong.

Maybe we never found the missing link because it doesn't exist and we didn't evolve from other types of humanoids, we lived along side of them. Maybe they no longer exist because we killed them all. I'm not saying this is true, just an alternate theory. There was a pasta in the last thread like this claiming Neanderthals were nocturnal cannibals that hunted us as prey and this is where our concept of vampires and primitive fear of the dark stems from. It was pretty interesting. I didn't save it unfortunately.

Ayden Lewis
Ayden Lewis

I suggest you copy my ID from above this post and look at what I've posted ITT. Your "REDPILLS" are babby tier in scope in comparison to what I've already said. I've outlined the humanity's entire (currently known) written history as far more darker than you apparently have dreamt it in your worst nightmares.

Easton Gomez
Easton Gomez

First moon landing was real, the rest were hoaxes

Eli Brooks
Eli Brooks

I love you too, buddy. The irony in your meme flag is palpable.

Hunter Fisher
Hunter Fisher

What do you think happens to a souls when someone dies?

Christopher Campbell
Christopher Campbell

im a guy and im cuter than u

Disable AdBlock to view this page

Disable AdBlock to view this page

Confirm your age

This website may contain content of an adult nature. If you are under the age of 18, if such content offends you or if it is illegal to view such content in your community, please EXIT.

Enter Exit

About Privacy

We use cookies to personalize content and ads, to provide social media features and to analyze our traffic. We also share information about your use of our site with our advertising and analytics partners.

Accept Exit