Why are the British like this?

>British
>Whote

>White

he is hiding his neck so could be

worry not, nothing on that neck.

Attached: 1567614905855.jpg (449x665, 61K)

being anglo is being a demon

Attached: 1564920257154.jpg (962x1026, 224K)

is this what you find attractive? wtf
at least weebs wanna fuck little girls

u sure about that micky?

Attached: 1564779834679.jpg (2048x1366, 252K)

Lord help me....

>that bellowing demonic tone of voice in Norf-tier working class brits

Can someone explain to me why Jow Forums can't recognise this one as just another vapid attentionwhore?
Is your only standard for a woman really that she shouldn't be fat or a Leftie?

What a spritely young lass! I'd let her manoeuvre my lever, if you catch my meaning.

You would think my .000009% negro blood would make me twice as bad as an anglo.

>fingolia of all countries

Now we just need brazil, bulgaria and some other shithole claiming America is "very mixed" and we'll have a fucking party

Attached: whites are mutts.jpg (640x758, 229K)

in a weird way remind me Diana.

Attached: tumblr_nlqojf88lP1tch55to2_r1_1280.jpg (805x793, 254K)

jajajaja come mierda putaaaaaa

just an eye candy.

pic related is a 10/10 in bongland

Attached: 1553945103643.jpg (1600x1066, 284K)

ummm wrong again polandcuck

Attached: oicunt.jpg (660x792, 151K)

>that face
>that skull
>that dental arch
>those long lanky arms
>pants belted halfway up the abdomen to conceal the lack of any hips and masculine waistline

Got some news for you user

Attached: THATS A MAN BABY.jpg (430x322, 33K)

really starting to like the silver haired one after seeing her nearly every day thanks user

fpbp

Attached: af7.png (288x302, 56K)

What's the problem? If you act like a cunt you get a slap. The spick deserved it.

In Britain you would not get in trouble for reacting like that if someone mocked you over a health issue because the disabled are venerated. She probably forgot she was in another country.

Jesus christ, britbongs are NOT white.

To be fair the bongs get a bad wrap, their tabloid newspapers leech on to this behaviour and advertise it. Poland, Hungary, Spain, Italy, France and Germany all have our severe degenerates yet the tabloids are not as hellbent on promoting it as the bong’s tabloids are. Middle class Britain is nothing like this and most working class Brit’s would scoff at this behaviour also

what does the average bog dna look like?

Attached: serveimage-33.jpg (171x295, 9K)

Britain is basically a caste system. They just don't realise it.

>gets a glass thrown at him
>gets his micropenis mocked
>'s-so sorry to b-bother you all'
>leaves the party immediately with tears streaming, shit and piss running down his legs

the absolute state of eurocuckoldry

British tourist, it cant be worse. Maybe just poor russians or trailer Americans. And i fucking travel a lot

because you are a bong. you are not human., I could just post pics of pigs and you would shag that you subhuman bong

Attached: bongswouldshagthis.jpg (750x499, 62K)

tfw that landwhale isn't even technically considered ugly in the UK.

Also, can we acknowledge that aussie slags are just as fugly as their anglo-whale sisters in the UK? Seriously, aussie slags can be pretty damn disgusting too but NOOOOOOO, we only make fun of UK anglo-whales.

Attached: 15510320856701.jpg (1333x10000, 3.43M)

I still can't put my finger on it but there's something about the way a British slag looks that makes her instantly recognisable.
If I saw one of those specimens anywhere in the world I would assume right away that they were Brits. There's just something away they dress or do their makeup or carry themselves or a combination of it all that instantly informs it.

Nice try, but that's Tammy Slaton and she's American.

Whiter than you Jamal

We realise it. The lower caste don't.

That’s a trannie. Huge hands and that’s just the start

lol that pic has potential

Attached: laff.png (247x262, 160K)

3 out of 4 mutts are obese

they misspelled ogre

>brits
>white

Attached: gfgfgffggfgffg.jpg (587x633, 128K)

So one group taunted her group and then couldn't handle the reprisal. Sounds just like Jow Forums.

Attached: 1547853677113.jpg (382x432, 19K)

I don't get it, pol. Why do trannies get free hormone injections and gender reassignment surgery but a women who gets a double mastectomy has to pay for a boob job?

Is this the "free speech does not mean freedom from consequences" thing? A person can physically assault you if they don't like what you say. That sure would be much easier than thinking up a witty reply. Or a thoughtful explanation to correct the person and make them a better person. No just crack em over the head thats the thing!

>Um tellin ye Marta, he took all me fookin food n just left me and lil Nigel like a fookin poofta!

True, the eternal anglo is a plight on this world

You're just recognizing your own Viking genes in them.

yea that's what I meant.
If they ever manage to work this out as a group... yea nah, they will be too pissed to do anything

Vikings took all the attractive British women with them when they came. The ones that remained were too ugly to touch

dont think krauts are any better you unholy parasitic force on europe

If British people have Viking genes it's similar to how Orcs in LOTR have Elvish genes but have been corrupted.

British people = Orcs?
Tolkien even admits that Black speech writing was partly based on Welsh.

It's a painful truth. Our women are generally ugly. I went to Latvia 15 years ago for my wedding anniversary and crikey 8/10s were standard. I actually saw a 10/10 in a coffee shop in a book store. Similar deal in Eastern Europe in general. But Sweden was a disappointment. Gothenburg 20 years ago was terrible. Gutted. USA is worse than the UK.

Every royal since 1688 has been German you illiterate mong. The House of Orange-Nassau, Hannover, Saxe Coburg Gotha are all German. The British Empire hired Hessian mercinaries because the German kings here didn't want a bong standing army.

Welsh people and their language are BASED. It's the Engl*sh that are the true disgusting satanic creatures of the UK,

Slavic women in general are pretty good if they're not drinking Vodka by age 12.

This

Can't disagree with you on that one

>British women are far more trashier than American women.

Attached: ww.jpg (3431x1415, 995K)

Depends where you live. Middle class areas have decent women. Working class, usually don't. It is simple nutrition : poor people eat shit food.

Attached: kings.jpg (1280x720, 95K)

size od hands/feet is not 1:1 with the rest (same goes also for head), smaller more petite people still have them appearin as a lil bit bigger than they should.

I'd say no way these eyes are masculine, but surgery would fix that.

I will say that that waist, leg-torso ratio is nott something you can fix or make up.

Attached: 1549498872719.jpg (480x767, 70K)

Because ALL BRITS are NORF and are NOT HUMAN

Attached: 1542175475675.png (1134x832, 594K)

>trashier than American women.

Attached: 10 in America.webm (640x360, 896K)

I'm Welsh and the language is pointless. It's rammed down your throat. Apart from areas of the north and west, it's not spoken at all. Everything is translated. Costs millions. Wales is great but let's get real.

That's why niggers are not human they are unable to come up with a coherent counterpoint but muh dick or violence. That is why violence is the only option to the negro question.

Attached: 1563465998640.png (610x888, 83K)

>I'm Welsh
Post sheep

Attached: file.png (900x507, 875K)

Norf are the industrious ones. The Souf are where the elites live, the financiers and City parasites.

You cowards couldnt handle that Norf pussy, this is where the colonial Anglo shines.

We will fuck ANYTHING, your country, your ugly nigger women, our ugly women. NOTHING can hide from the anglo cock

Judging British women purely by low-class slags posted on Jow Forums would be like judging all American women as the fat, pierced, multicolour haired, bespectacled American dykes posted here. Those are outliers, so you shouldn't think women like that are your average American or Brit.

Attached: BEADY.jpg (1317x1508, 569K)

I don't subscribe to your point of view. If poverty is an issue how is eastern Europe up to its nuts in absolute quality totty? Food in eastern Europe isn't great. Food in the UK is far better. There are fewer fatties in the east. I'd say poverty makes for better looking people. The USA is wealthy but I've never seen a decent woman in my visits.

holy fucking based

stfu NORF no one asked u

Attached: 1527155295273.png (1946x708, 161K)

Attached: women-feminism-men-uk-equality-854568.jpg (590x393, 75K)

We fuck em and then you eat em. Extra gravy?

those girls belong to America

Attached: ameriboos.jpg (809x1080, 293K)

don't forget about this prime american beaut

Attached: 1550796162273.webm (640x800, 1.78M)

TAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAAC
CCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCAACCCTAACCCTAACCCTAACCCTAACCCTAA
CCCTAACCCCTAACCCTAACCCTAACCCTAACCCTAACCTAACCCTAACCCTAACCCTAACCCTAACCCT
AACCCTAACCCTAACCCTAACCCCTAACCCTAACCCTAAACCCTAAACCCTAACCCTAACCCTAACCCTA
ACCCTAACCCCAACCCCAACCCCAACCCCAACCCCAACCCCAACCCTAACCCCTAACCCTAACCCTAACC
CTACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCCTAACCCCTAACCCTAACCCTAACCCTA
ACCCTAACCCTAACCCTAACCCCTAACCCTAACCCTAACCCTAACCCTCGCGGTACCCTCAGCCGGCCCG
CCCGCCCGGGTCTGACCTGAGGAGAACTGTGCTCCGCCTTCAGAGTACCACCGAAATCTGTGCAGAGGAC
AACGCAGCTCCGCCCTCGCGGTGCTCTCCGGGTCTGTGCTGAGGAGAACGCAACTCCGCCGTTGCAAAGG
CGCGCCGCGCCGGCGCAGGCGCAGAGAGGCGCGCCGCGCCGGCGCAGGCGCAGAGAGGCGCGCCGCGCCG
GCGCAGGCGCAGAGAGGCGCGCCGCGCCGGCGCAGGCGCAGAGAGGCGCGCCGCGCCGGCGCAGGCGCAG
AGAGGCGCGCCGCGCCGGCGCAGGCGCAGACACATGCTAGCGCGTCGGGGTGGAGGCGTGGCGCAGGCGC
AGAGAGGCGCGCCGCGCCGGCGCAGGCGCAGAGACACATGCTACCGCGTCCAGGGGTGGAGGCGTGGCGC
AGGCGCAGAGAGGCGCACCGCGCCGGCGCAGGCGCAGAGACACATGCTAGCGCGTCCAGGGGTGGAGGCG
TGGCGCAGGCGCAGAGACGCAAGCCTACGGGCGGGGGTTGGGGGGGCGTGTGTTGCAGGAGCAAAGTCGC
ACGGCGCCGGGCTGGGGCGGGGGGAGGGTGGCGCCGTGCACGCGCAGAAACTCACGTCACGGTGGCGCGG
CGCAGAGACGGGTAGAACCTCAGTAATCCGAAAAGCCGGGATCGACCGCCCCTTGCTTGCAGCCGGGCAC
TACAGGACCCGCTTGCTCACGGTGCTGTGCCAGGGCGCCCCCTGCTGGCGACTAGGGCAACTGCAGGGCT
CTCTTGCTTAGAGTGGTGGCCAGCGCCCCCTGCTGGCGCCGGGGCACTGCAGGGCCCTCTTGC
etc. etc.

I see 10s every fucking day. Say what you will about Portland Oregon but we have the most strippers per capita and most of our women fall on the upper end of things unless they write fan fiction.

Jesus man how far has the UK fallen?

based. life would be a mistake if anglos didn't exist.

jesus christ how horrifying

Attached: 1541423890446.png (645x773, 24K)

Attached: 1561829897413.jpg (600x800, 364K)

They bloody do realise it:
>AHM AH PROWD MEMBUH UF THA WERKIN-CLASS

Attached: 1f42a74a427cb2ec569522b50cfc7522.png (768x1024, 1.18M)

I eat mutton but I don't eat the vagina from it.
I'll bet the Chinamen do, though.

>oval office

I'd like to get a tour around her ovulation office, if you catch my drift he heh.

Attached: 1549650352925.webm (600x900, 2.86M)

Are you bisexual Bhutan user again?
Of all the flags you could use for a VPN why that one.

Attached: 1502865622222s.jpg (250x164, 6K)

noice teef